•   Search CZRC
  •   Search CZRC for  
Login | Register
Chinese | English
Home:Resources > Mutant Line
    • 基准单价：
      Commercial:¥2600(Adults)/Unit  ¥1600(Embryos)/Unit  ¥6000(Frozen sperm)/Unit  
      Non-commercial:¥1300(Adults)/Unit  ¥800(Embryos)/Unit  ¥3000(Frozen sperm)/Unit  
      Price Detail
    • The CZRC is a non-profit organization. The prices we charge for products and services are to offset some of the actual costs we incur.
    • Please acknowledge the CZRC in all publications resulting from the materials and/or services we are providing to you. Thank you!
    CZRZ Catalog ID: CZ453
    Availability: Frozen sperm
    Genotype: msx3ihb246/+
    Affected Gene:  msx3
    Genotyping: pdf
    GENOTYPE COMPOSITION
    Genomic Feature Zygosity Parental Genotype Lab of Origin Construct
    ihb246 heterozygous Yong-Hua Sun Lab
    Background: AB Affectedgeneurl: unspecified Linetype: Mutant Previous Names: unspecified Background: AB Affectedgeneurl: unspecified Linetype: Mutant Previous Names: unspecified
    Note:
    Between 297 bp to 305 bp of the wild-type msx3 coding sequence, AGTGGAGAG is mutated to TATCTGCGTAAAGCGACACACTACA in exon 1.
    Links:
    More
    © China Zebrafish Resource Center. All rights reserved.
     
    CZRC Home | Guidelines for Ordering | Technical Service | FAQ | Contact Us
    Web Support: Taizhou Xing-Ao Network Technology Co., Ltd.