• 基准单价:
    Commercial:¥2600(Adults)/Unit  ¥1600(Embryos)/Unit  ¥6000(Frozen sperm)/Unit  
    Non-commercial:¥1300(Adults)/Unit  ¥800(Embryos)/Unit  ¥3000(Frozen sperm)/Unit  
    Price Detail
  • The CZRC is a non-profit organization. The prices we charge for products and services are to offset some of the actual costs we incur.
  • Please acknowledge the CZRC in all publications resulting from the materials and/or services we are providing to you. Thank you!
CZRZ Catalog ID: CZ192
Availability: Frozen sperm
Genotype: pde6cihb74/+
Affected Gene: pde6c (eclipse, pde6 alpha prime, zgc:73085)
Genotyping: pdf
GENOTYPE COMPOSITION
Genomic Feature Zygosity Parental Genotype Lab of Origin Construct
ihb74 heterozygous +/- X ♀+/+ Fish Developmental Biotechnology Lab
Background: AB Affectedgeneurl: unspecified Linetype: Mutant Previous Names: unspecified Background: AB Affectedgeneurl: unspecified Linetype: Mutant Previous Names: unspecified
Note:
Between 566 bp to 567 bp of the wild-type pde6c coding sequence, GGCAATAAACAATAAACAAACAATAAACAATAAACAATAAACAATAAACAA, is inserted. The mutated pde6c codes for a truncated protein containing 201 aa, 188 aa of which are identical to wildtype pde6c. Further MTA needed from the Fish Developmental Biotechnology Lab.