• 基准单价:
    Commercial:¥2600(Adults)/Unit  ¥1600(Embryos)/Unit  ¥6000(Frozen sperm)/Unit  
    Non-commercial:¥1300(Adults)/Unit  ¥800(Embryos)/Unit  ¥3000(Frozen sperm)/Unit  
    Price Detail
  • The CZRC is a non-profit organization. The prices we charge for products and services are to offset some of the actual costs we incur.
  • Please acknowledge the CZRC in all publications resulting from the materials and/or services we are providing to you. Thank you!
CZRZ Catalog ID: CZ93
Availability: Frozen sperm
Genotype: socs3aihb31/+
Affected Gene: socs3a (socs3, fj09e12, wu:fj09e12, zgc:56537 )
Genotyping: pdf
GENOTYPE COMPOSITION
Genomic Feature Zygosity Parental Genotype Lab of Origin Construct
ihb31 homozygous Fish Developmental Biotechnology Lab
Background: AB Affectedgeneurl: unspecified Linetype: Mutant Previous Names: unspecified Background: AB Affectedgeneurl: unspecified Linetype: Mutant Previous Names: unspecified
Note:
his mutant contains a deletion from bp221 to 281 of the wildtype socs3a coding sequence, CGGCCTGTTTGACGCTAGCATGCGGCTGCCGTTTTACCACTTCAAGACCTTCAGCTCCAAG, is deleted. The mutated socs3a codes for a protein containing 44 aa, in which only the sequence of the first 12 aa is identical to wildtype socs3a. Further MTA needed from the Fish Developmental Biotechnology Lab.