Select Product Note CZRC
Catalog ID
Further MTA needed from the Yong-Hua Sun Lab. CZ394
Further MTA needed from the Yong-Hua Sun Lab. CZ395
Further MTA needed from the Yong-Hua Sun Lab. CZ396
Further MTA needed from the Yong-Hua Sun Lab. CZ397
Further MTA needed from the Yong-Hua Sun Lab. CZ398
Between 2930 bp to 2936 bp of the wild-type gbf1 coding sequence, GGCTCAG is deleted in exon 22. The mutated gbf1 codes for a truncated protein containing 993 aa, of which 1735 aa are identical to wildtype gbf1. CZ402
In the wild-type sec14l8 coding sequence, GACATGAGCG is deleted in start codon. The mutated sec14l8 codes for a truncated protein containing 341 aa, of which 395 aa are identical to wildtype sec14l8. CZ403
tsu4305 mutant embryos carry a C to A single nucleotide substitution in the 9rd exon. This C to A mutation is predicted to cause an Ala to Asp substitution in Cdc6 protein CZ404
In the wild-type cdc6 coding sequence, GACATGAGCG is deleted in exon 3. The mutated cdc6 codes for a truncated protein containing 141 aa, of which 361 aa are identical to wildtype cdc6. CZ405
In the wild-type cdc6 coding sequence, AAGCAGCGCTGCGCTCCTCTG is deleted in exon 2. The mutated cdc6 codes for a truncated protein containing 554 aa, of which 361 aa are identical to wildtype cdc6. CZ406
FirstPrev...29303132333435363738NextLast  Go