Select Product Note CZRC
Catalog ID
149 bp to 151 bp of the wildtype cadm1a coding sequence, TGG, is mutated into ACAGCCTACT. The mutated cadm1a codes for a truncated protein containing 66 aa, of which 49 aa are identical to wildtype cadm1a. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ204
Between 136 bp to 144 bp of the wild-type fundc2 coding sequence, TGGCCAT, is deleted. The mutated fundc2 codes for a truncated protein containing 48 aa, 45 aa of which is identical to wildtype fundc2. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ205
Between 117 bp to 144 bp of the wild-type fundc2 coding sequence, TACTCTGTGGCCACACAGCTGGCCAT, is deleted. The mutated fundc2 codes for a truncated protein containing 78 aa, 39 aa of which is identical to wildtype fundc2. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ206
140 bp to 146 bp of the wild-type fundc2 coding sequence, CATTG, is mutated into GAGT. The mutated fundc2 codes for a truncated protein containing 50 aa, 46 aa of which are identical to wildtype fundc2. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ207
Between 313 bp to 331 bp of the wild-type KIAA0101 coding sequence, GATCCTCGAACGCGCAG, is deleted. The mutated KIAA0101 codes for a truncated protein containing 114 aa, 104 aa of which are identical to wildtype KIAA0101. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ208
Between 328 bp to 348 bp of the wild-type KIAA0101 coding sequence, AGAGCGGCAGCGCGCAGTC, is deleted. The mutated KIAA0101 codes for a prolonged protein containing 302 aa, 109 aa of which are identical to wildtype KIAA0101. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ209
Between 1302 bp to 1303 bp of the wild-type nhsa coding sequence, GAGTCAT, is inserted. The mutated nhsa codes for a truncated protein containing 436 aa, 434 aa of which are identical to wildtype nhsa. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ210
Between 1303 bp to 1306 bp of the wild-type nhsa coding sequence, GATG, is deleted. The mutated nhsa codes for a truncated protein containing 465 aa, 434 aa of which are identical to wildtype nhsa. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ211
Between 1304 bp to 1305 bp of the wild-type nhsa coding sequence, CTGGTGACTGG, is inserted. The mutated nhsa codes for a truncated protein containing 436 aa, 434 aa of which are identical to wildtype nhsa. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ212
Between 631 bp to 632 bp of the wild-type nlgn2a coding sequence, CTAA, is inserted. The mutated nlgn2a codes for a truncated protein containing 229 aa, 210 aa of which are identical to wildtype nlgn2a. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ213
FirstPrev...17181920212223242526...NextLast  Go