Select Product Note CZRC
Catalog ID
If you need this mutant line, please contact Dr. Kim, Cheol-Hee at the Kim Lab to obtain a further MTA. Thank you! CZ184
If you need this mutant line, please contact Dr. Kim, Cheol-Hee at the Kim Lab to obtain a further MTA. Thank you! CZ185
visual perception decreased process quality; retinal cone cell photoreceptor outer segment increased length; retinal rod cell degeneration CZ186
Between 216 bp to 224 bp of the wild-type trim47 coding sequence, GATGTGG, is deleted. The mutated trim47 codes for a truncated protein containing 195 aa, of which 479 aa are identical to wildtype trim47. CZ187
Between 643 bp to 651 bp of the wild-type namptb coding sequence, ACCGTGG, is deleted. The mutated namptb codes for a truncated protein containing 495 aa, of which 498 aa are identical to wildtype namptb. CZ188
Between 215 bp to 221 bp of the wild-type trim47 coding sequence, TGATG, is deleted. The mutated trim47 codes for a truncated protein containing 78 aa, of which 479 aa are identical to wildtype trim47. CZ189
644 bp to 651 bp of the wildtype namptb coding sequence, TGG, is mutated into ACAGCCTACT. The mutated namptb codes for a truncated protein containing 266 aa, of which 498 aa are identical to wildtype namptb CZ190
Between 568 bp to 569 bp of the wild-type pde6c coding sequence, CA, is inserted. The mutated pde6c codes for a truncated protein containing 193 aa, 189 aa of which are identical to wildtype pde6c.Further MTA needed from the Fish Developmental Biotechnology Lab. CZ191
Between 566 bp to 567 bp of the wild-type pde6c coding sequence, GGCAATAAACAATAAACAAACAATAAACAATAAACAATAAACAATAAACAA, is inserted. The mutated pde6c codes for a truncated protein containing 201 aa, 188 aa of which are identical to wildtype pde6c. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ192
Between 568 bp to 569 bp of the wild-type pde6c coding sequence, CAATCAA, is inserted. The mutated pde6c codes for a truncated protein containing 207 aa, 189 aa of which are identical to wildtype pde6c. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ193
FirstPrev...15161718192021222324...NextLast  Go