Select Product Note CZRC
Catalog ID
CZ82
This mutant contains a deletion from bp24 to 36 of the wildtype socs2 coding sequence, CACGGAAAGCATC, is deleted. The mutated socs2 codes for a protein containing 31 aa, in which only the sequence of the first 8 aa is identical to wildtype socs2. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ92
his mutant contains a deletion from bp221 to 281 of the wildtype socs3a coding sequence, CGGCCTGTTTGACGCTAGCATGCGGCTGCCGTTTTACCACTTCAAGACCTTCAGCTCCAAG, is deleted. The mutated socs3a codes for a protein containing 44 aa, in which only the sequence of the first 12 aa is identical to wildtype socs3a. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ93
Between the 313 bp and 315 bp of the wildtype socs1a coding sequence, a cytosine(C), is deleted. The mutated socs1a codes for a protein containing 63 aa, in which only the sequence of the first 22 aa is identical to wildtype socs1a. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ94
This mutant contains a deletion from bp31 to 41 of the wildtype socs2 coding sequence, AGCATCGAGAA, is deleted. The mutated socs2 codes for a protein containing 10 aa, and the sequence of the 10 aa is identical to wildtype socs2. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ95
This mutant contains a deletion from bp456 to 465 of the wildtype socs3b coding sequence, CAAACTGCAG, is deleted. The mutated socs3b codes for a protein containing 52 aa, in which only the sequence of the first 44 aa is identical to wildtype socs3b. Further MTA needed from the Fish Developmental Biotechnology Lab. CZ97
macrophage-specific GFP CZ98
CZ102
sustainably expressed from hepatoblasts and liver progenitor cells in liver primordium to hepatocyte CZ103
CZ104
FirstPrev...78910111213141516...NextLast  Go